BioLiP

>dna
ctataaaagggggtgggggcgcgttcgtcctcagtcgcgatcgaacactcgagccgagcagacgtgcctacg

The query sequence (length=72) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5fur:F	80	72	1.0000	0.9000	1.0000	3.88e-34	6mzm:U
2	5fur:E	80	72	1.0000	0.9000	1.0000	3.88e-34	6mzm:V
3	7egj:Y	74	72	1.0000	0.9730	1.0000	3.88e-34
4	7egj:X	74	72	1.0000	0.9730	1.0000	3.88e-34
5	7egd:Y	72	72	1.0000	1.0000	1.0000	3.88e-34
6	7egd:X	72	72	1.0000	1.0000	1.0000	3.88e-34
7	5iyc:Y	80	71	0.9861	0.8875	1.0000	1.40e-33	5iyd:Y
8	5iy8:Y	83	72	0.9861	0.8554	0.9861	1.81e-32	5iy9:Y
9	5iy7:Y	77	68	0.9444	0.8831	1.0000	6.50e-32
10	5iyb:Y	75	66	0.9167	0.8800	1.0000	8.40e-31
11	7eg9:Y	71	64	0.8889	0.9014	1.0000	1.09e-29
12	7eg9:X	71	64	0.8889	0.9014	1.0000	1.09e-29
13	7eg7:Y	71	63	0.8750	0.8873	1.0000	3.91e-29
14	7eg7:X	71	63	0.8750	0.8873	1.0000	3.91e-29
15	7egb:Y	69	61	0.8472	0.8841	1.0000	5.06e-28	7ena:Y, 7enc:Y
16	7egb:X	69	61	0.8472	0.8841	1.0000	5.06e-28	7ena:X, 7enc:X
17	5iy6:Y	65	56	0.7778	0.8615	1.0000	3.04e-25	6o9l:Y
18	5iy6:X	65	56	0.7778	0.8615	1.0000	3.04e-25	6o9l:X
19	7lbm:V	64	55	0.7639	0.8594	1.0000	1.09e-24
20	7lbm:U	64	55	0.7639	0.8594	1.0000	1.09e-24
21	5iya:Y	59	50	0.6944	0.8475	1.0000	6.59e-22
22	5iya:X	59	50	0.6944	0.8475	1.0000	6.59e-22
23	8gxq:Y	67	59	0.7639	0.8209	0.9322	1.10e-19	8gxs:Y
24	8gxq:X	67	59	0.7639	0.8209	0.9322	1.10e-19	8gxs:X
25	7egh:Y	45	45	0.6250	1.0000	1.0000	3.97e-19
26	7egh:X	45	45	0.6250	1.0000	1.0000	3.97e-19
27	5iy7:X	77	68	0.8194	0.7662	0.8676	6.64e-17
28	5iyb:X	75	66	0.7917	0.7600	0.8636	8.58e-16
29	7nvt:T	50	36	0.4861	0.7000	0.9722	1.86e-12
30	7nvt:N	50	33	0.4583	0.6600	1.0000	1.86e-12
31	7nvs:T	49	36	0.4861	0.7143	0.9722	1.86e-12
32	7nvs:N	49	33	0.4583	0.6735	1.0000	1.86e-12
33	7nvr:T	64	36	0.4861	0.5469	0.9722	1.86e-12	7nvy:T, 7nvz:T
34	7nvr:N	64	33	0.4583	0.5156	1.0000	1.86e-12	7nvy:N, 7nvz:N
35	8byq:T	198	36	0.4861	0.1768	0.9722	1.86e-12	8bz1:T
36	8byq:N	198	33	0.4583	0.1667	1.0000	1.86e-12	8bz1:N
37	8bvw:T	206	36	0.4861	0.1699	0.9722	1.86e-12
38	8bvw:N	206	33	0.4583	0.1602	1.0000	1.86e-12
39	5iy8:X	83	32	0.4444	0.3855	1.0000	6.68e-12	5iy9:X
40	5iyc:X	80	31	0.4306	0.3875	1.0000	2.40e-11	5iyd:X

[Back]