BioLiP

>dna
cctataaaagggggtgggggcgcgttcgtcctcagtcgcgatcgaacactcgagccgagcagacgtgcctacgg

The query sequence (length=74) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5fur:F	80	74	1.0000	0.9250	1.0000	3.11e-35	6mzm:U
2	5fur:E	80	74	1.0000	0.9250	1.0000	3.11e-35	6mzm:V
3	7egj:Y	74	74	1.0000	1.0000	1.0000	3.11e-35
4	7egj:X	74	74	1.0000	1.0000	1.0000	3.11e-35
5	5iyc:Y	80	72	0.9730	0.9000	1.0000	4.02e-34	5iyd:Y
6	7egd:Y	72	72	0.9730	1.0000	1.0000	4.02e-34
7	7egd:X	72	72	0.9730	1.0000	1.0000	4.02e-34
8	5iy8:Y	83	74	0.9865	0.8795	0.9865	1.45e-33	5iy9:Y
9	5iy7:Y	77	69	0.9324	0.8961	1.0000	1.87e-32
10	5iyb:Y	75	67	0.9054	0.8933	1.0000	2.42e-31
11	7eg9:Y	71	65	0.8784	0.9155	1.0000	3.13e-30
12	7eg9:X	71	65	0.8784	0.9155	1.0000	3.13e-30
13	7eg7:Y	71	64	0.8649	0.9014	1.0000	1.13e-29
14	7eg7:X	71	64	0.8649	0.9014	1.0000	1.13e-29
15	7egb:Y	69	62	0.8378	0.8986	1.0000	1.46e-28	7ena:Y, 7enc:Y
16	7egb:X	69	62	0.8378	0.8986	1.0000	1.46e-28	7ena:X, 7enc:X
17	5iy6:Y	65	57	0.7703	0.8769	1.0000	8.76e-26	6o9l:Y
18	5iy6:X	65	57	0.7703	0.8769	1.0000	8.76e-26	6o9l:X
19	7lbm:V	64	56	0.7568	0.8750	1.0000	3.15e-25
20	7lbm:U	64	56	0.7568	0.8750	1.0000	3.15e-25
21	5iya:Y	59	51	0.6892	0.8644	1.0000	1.90e-22
22	5iya:X	59	51	0.6892	0.8644	1.0000	1.90e-22
23	8gxq:Y	67	60	0.7568	0.8358	0.9333	3.17e-20	8gxs:Y
24	8gxq:X	67	60	0.7568	0.8358	0.9333	3.17e-20	8gxs:X
25	7egh:Y	45	45	0.6081	1.0000	1.0000	4.11e-19
26	7egh:X	45	45	0.6081	1.0000	1.0000	4.11e-19
27	5iy7:X	77	69	0.8108	0.7792	0.8696	1.91e-17
28	5iyb:X	75	67	0.7838	0.7733	0.8657	2.47e-16
29	7nvt:T	50	36	0.4730	0.7000	0.9722	1.92e-12
30	7nvt:N	50	33	0.4459	0.6600	1.0000	1.92e-12
31	7nvs:T	49	36	0.4730	0.7143	0.9722	1.92e-12
32	7nvs:N	49	33	0.4459	0.6735	1.0000	1.92e-12
33	7nvr:T	64	36	0.4730	0.5469	0.9722	1.92e-12	7nvy:T, 7nvz:T
34	7nvr:N	64	33	0.4459	0.5156	1.0000	1.92e-12	7nvy:N, 7nvz:N
35	5iy8:X	83	33	0.4459	0.3976	1.0000	1.92e-12	5iy9:X
36	8byq:T	198	36	0.4730	0.1768	0.9722	1.92e-12	8bz1:T
37	8byq:N	198	33	0.4459	0.1667	1.0000	1.92e-12	8bz1:N
38	8bvw:T	206	36	0.4730	0.1699	0.9722	1.92e-12
39	8bvw:N	206	33	0.4459	0.1602	1.0000	1.92e-12
40	5iyc:X	80	31	0.4189	0.3875	1.0000	2.49e-11	5iyd:X

[Back]