ccgtttccaacgaaggcctcaaagcggtccaaatatccact
The query sequence (length=41) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7r5s:i | 41 | 41 | 1.0000 | 1.0000 | 1.0000 | 3.33e-17 | |
| 2 | 7r5s:J | 41 | 41 | 1.0000 | 1.0000 | 1.0000 | 3.33e-17 | |
| 3 | 7yyh:i | 152 | 32 | 0.7805 | 0.2105 | 1.0000 | 3.35e-12 | |
| 4 | 7yyh:J | 153 | 32 | 0.7805 | 0.2092 | 1.0000 | 3.35e-12 | |
| 5 | 7r5v:J | 32 | 32 | 0.7805 | 1.0000 | 1.0000 | 3.35e-12 | |
| 6 | 7r5v:i | 31 | 30 | 0.7317 | 0.9677 | 1.0000 | 4.33e-11 |
zhanggroup.org