cccggtgccgaggccgctcttttggacgaagacagcacaagcaccgcaaaaacgcacgaacgcgcagacccccgcgaaaa
aaccgccaaggggaaaacacccaagacaccaggcacgagacagaaaaaaacaacgaaaacggccaccacccaaacacacc
aaacac
The query sequence (length=166) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7xsz:T | 166 | 166 | 1.0000 | 1.0000 | 1.0000 | 5.36e-86 | |
2 | 7xsz:N | 155 | 132 | 0.7952 | 0.8516 | 1.0000 | 4.26e-67 | |
3 | 6a5o:T | 178 | 166 | 0.8976 | 0.8371 | 0.8976 | 1.20e-57 | 8jh4:T |
4 | 6j4w:T | 171 | 163 | 0.8795 | 0.8538 | 0.8957 | 5.59e-56 | |
5 | 7unc:T | 155 | 145 | 0.8012 | 0.8581 | 0.9172 | 2.60e-54 | |
6 | 6a5p:T | 168 | 160 | 0.8614 | 0.8512 | 0.8938 | 2.60e-54 | |
7 | 6a5o:N | 169 | 158 | 0.8494 | 0.8343 | 0.8924 | 3.37e-53 | |
8 | 7und:T | 131 | 124 | 0.6687 | 0.8473 | 0.8952 | 5.71e-41 | |
9 | 7xtd:T | 123 | 107 | 0.5964 | 0.8049 | 0.9252 | 7.39e-40 | |
10 | 8jh4:N | 166 | 166 | 0.8253 | 0.8253 | 0.8253 | 2.68e-34 | |
11 | 7xtd:N | 112 | 70 | 0.4217 | 0.6250 | 1.0000 | 1.25e-32 | |
12 | 7unc:N | 140 | 73 | 0.4337 | 0.5143 | 0.9863 | 1.25e-32 | |
13 | 7xt7:T | 126 | 118 | 0.5904 | 0.7778 | 0.8305 | 5.83e-26 | |
14 | 7xsx:T | 108 | 108 | 0.5301 | 0.8148 | 0.8148 | 2.11e-20 |