cccggacctgtgacaaattgccctcagacgg
The query sequence (length=31) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8tit:A | 31 | 31 | 1.0000 | 1.0000 | 1.0000 | 7.59e-12 | 8tiz:A |
2 | 8tiq:B | 32 | 31 | 1.0000 | 0.9688 | 1.0000 | 7.59e-12 | 8tiw:B |
3 | 8tip:B | 32 | 31 | 1.0000 | 0.9688 | 1.0000 | 7.59e-12 | 8tiv:B |
4 | 8d8m:A | 32 | 31 | 1.0000 | 0.9688 | 1.0000 | 7.59e-12 | 8tiq:A, 8tis:A, 8tiu:A, 8tiw:A, 8tiy:A, 8tj1:A |
5 | 8d86:A | 32 | 31 | 1.0000 | 0.9688 | 1.0000 | 7.59e-12 | 8tip:A, 8tir:A, 8tiv:A, 8tix:A, 8tj0:A, 7u6k:A, 7uxy:A |
6 | 8tir:B | 32 | 30 | 0.9677 | 0.9375 | 1.0000 | 2.73e-11 | 8tix:B, 7uxy:B |
7 | 8d8m:B | 32 | 30 | 0.9677 | 0.9375 | 1.0000 | 2.73e-11 | 8tis:B, 8tiy:B |
8 | 8tiu:B | 32 | 29 | 0.9355 | 0.9062 | 1.0000 | 9.81e-11 | 8tj1:B |
9 | 8tit:B | 31 | 29 | 0.9355 | 0.9355 | 1.0000 | 9.81e-11 | 8tiz:B |
10 | 8d86:B | 32 | 29 | 0.9355 | 0.9062 | 1.0000 | 9.81e-11 | 8tj0:B, 7u6k:B |