ccagctccctgctggctccgagtgggttctgccgctct
The query sequence (length=38) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8w8e:T | 45 | 38 | 1.0000 | 0.8444 | 1.0000 | 1.38e-15 | 8w8f:T |
| 2 | 8oeu:T | 38 | 38 | 1.0000 | 1.0000 | 1.0000 | 1.38e-15 | 8oev:T, 8oew:T |
| 3 | 6gmh:T | 48 | 38 | 1.0000 | 0.7917 | 1.0000 | 1.38e-15 | 6ted:T |
| 4 | 8a40:T | 41 | 38 | 1.0000 | 0.9268 | 1.0000 | 1.38e-15 | |
| 5 | 8a3y:T | 138 | 38 | 1.0000 | 0.2754 | 1.0000 | 1.38e-15 | |
| 6 | 8of0:T | 37 | 37 | 0.9737 | 1.0000 | 1.0000 | 4.95e-15 | |
| 7 | 7b0y:T | 37 | 36 | 0.9474 | 0.9730 | 1.0000 | 1.78e-14 | |
| 8 | 7ycx:d | 45 | 38 | 0.9737 | 0.8222 | 0.9737 | 6.40e-14 | |
| 9 | 8p4b:T | 35 | 35 | 0.9211 | 1.0000 | 1.0000 | 6.40e-14 |
zhanggroup.org