caacagcatgcgcgcccagggctgatcgtgcaaaagtcgtgccagc
The query sequence (length=46) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6gh5:F | 46 | 46 | 1.0000 | 1.0000 | 1.0000 | 6.00e-20 | |
| 2 | 6gfw:F | 50 | 46 | 1.0000 | 0.9200 | 1.0000 | 6.00e-20 | |
| 3 | 6gh6:T | 48 | 44 | 0.9565 | 0.9167 | 1.0000 | 7.76e-19 | |
| 4 | 7qwp:N | 36 | 31 | 0.6739 | 0.8611 | 1.0000 | 1.31e-11 | 7qxi:N |
| 5 | 7qv9:T | 36 | 31 | 0.6739 | 0.8611 | 1.0000 | 1.31e-11 | 7qwp:T, 7qxi:T |
| 6 | 5nss:H | 35 | 30 | 0.6522 | 0.8571 | 1.0000 | 4.70e-11 |
zhanggroup.org