atttcctcttgtcaggccggaataactccctataatgcgccatgacacggactctacgag
The query sequence (length=60) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7khb:X | 60 | 60 | 1.0000 | 1.0000 | 1.0000 | 1.44e-27 | |
| 2 | 7khb:Y | 64 | 64 | 1.0000 | 0.9375 | 0.9375 | 5.20e-22 | |
| 3 | 7szj:X | 57 | 60 | 0.9500 | 1.0000 | 0.9500 | 1.87e-21 | |
| 4 | 7khe:X | 54 | 57 | 0.9000 | 1.0000 | 0.9474 | 8.71e-20 | |
| 5 | 7khc:Y | 63 | 42 | 0.7000 | 0.6667 | 1.0000 | 1.46e-17 | |
| 6 | 7khc:X | 63 | 42 | 0.7000 | 0.6667 | 1.0000 | 1.46e-17 | |
| 7 | 7khi:X | 36 | 36 | 0.6000 | 1.0000 | 1.0000 | 3.15e-14 | |
| 8 | 7szj:Y | 49 | 31 | 0.5167 | 0.6327 | 1.0000 | 1.90e-11 | |
| 9 | 7khi:Y | 28 | 28 | 0.4667 | 1.0000 | 1.0000 | 8.83e-10 | |
| 10 | 7khe:Y | 46 | 28 | 0.4667 | 0.6087 | 1.0000 | 8.83e-10 |
zhanggroup.org