BioLiP

>dna
agggcgcctataaaagggggtgggggcgcgttcgtcctcagtcgcgatcgaacactcgagccgagcagacgtgcctacgg

The query sequence (length=80) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5fur:F	80	80	1.0000	1.0000	1.0000	1.58e-38	6mzm:U
2	5fur:E	80	80	1.0000	1.0000	1.0000	1.58e-38	6mzm:V
3	5iyc:Y	80	78	0.9750	0.9750	1.0000	2.05e-37	5iyd:Y
4	5iy8:Y	83	80	0.9875	0.9518	0.9875	7.36e-37	5iy9:Y
5	5iy7:Y	77	75	0.9375	0.9740	1.0000	9.52e-36
6	7egj:Y	74	74	0.9250	1.0000	1.0000	3.42e-35
7	7egj:X	74	74	0.9250	1.0000	1.0000	3.42e-35
8	5iyb:Y	75	73	0.9125	0.9733	1.0000	1.23e-34
9	7egd:Y	72	72	0.9000	1.0000	1.0000	4.43e-34
10	7egd:X	72	72	0.9000	1.0000	1.0000	4.43e-34
11	7eg9:Y	71	71	0.8875	1.0000	1.0000	1.59e-33
12	7eg9:X	71	71	0.8875	1.0000	1.0000	1.59e-33
13	7eg7:Y	71	70	0.8750	0.9859	1.0000	5.73e-33
14	7eg7:X	71	70	0.8750	0.9859	1.0000	5.73e-33
15	7egb:Y	69	68	0.8500	0.9855	1.0000	7.41e-32	7ena:Y, 7enc:Y
16	7egb:X	69	68	0.8500	0.9855	1.0000	7.41e-32	7ena:X, 7enc:X
17	5iy6:Y	65	63	0.7875	0.9692	1.0000	4.46e-29	6o9l:Y
18	5iy6:X	65	63	0.7875	0.9692	1.0000	4.46e-29	6o9l:X
19	7lbm:V	64	62	0.7750	0.9688	1.0000	1.60e-28
20	7lbm:U	64	62	0.7750	0.9688	1.0000	1.60e-28
21	5iya:Y	59	57	0.7125	0.9661	1.0000	9.65e-26
22	5iya:X	59	57	0.7125	0.9661	1.0000	9.65e-26
23	8gxq:Y	67	66	0.7750	0.9254	0.9394	1.62e-23	8gxs:Y
24	8gxq:X	67	66	0.7750	0.9254	0.9394	1.62e-23	8gxs:X
25	5iy7:X	77	75	0.8250	0.8571	0.8800	9.72e-21
26	5iyb:X	75	73	0.8000	0.8533	0.8767	1.26e-19
27	7egh:Y	45	45	0.5625	1.0000	1.0000	4.52e-19
28	7egh:X	45	45	0.5625	1.0000	1.0000	4.52e-19
29	5iy8:X	83	80	0.8250	0.7952	0.8250	3.52e-15	5iy9:X
30	5iyc:X	80	78	0.8000	0.8000	0.8205	4.55e-14	5iyd:X
31	7nvt:T	50	43	0.5000	0.8000	0.9302	5.89e-13
32	7nvt:N	50	40	0.4750	0.7600	0.9500	5.89e-13
33	7nvs:T	49	43	0.5000	0.8163	0.9302	5.89e-13
34	7nvs:N	49	40	0.4750	0.7755	0.9500	5.89e-13
35	7nvr:T	64	43	0.5000	0.6250	0.9302	5.89e-13	7nvy:T, 7nvz:T
36	7nvr:N	64	40	0.4750	0.5938	0.9500	5.89e-13	7nvy:N, 7nvz:N
37	8byq:T	198	43	0.5000	0.2020	0.9302	5.89e-13	8bz1:T
38	8byq:N	198	40	0.4750	0.1919	0.9500	5.89e-13	8bz1:N
39	8bvw:T	206	43	0.5000	0.1942	0.9302	5.89e-13
40	8bvw:N	206	40	0.4750	0.1845	0.9500	5.89e-13

[Back]