agacgcggacatcaagcccgccgtgaaggtgcagctgct
The query sequence (length=39) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7yhs:N | 39 | 39 | 1.0000 | 1.0000 | 1.0000 | 3.98e-16 | |
| 2 | 7eqg:N | 44 | 39 | 1.0000 | 0.8864 | 1.0000 | 3.98e-16 | |
| 3 | 6ne0:N | 44 | 36 | 0.9231 | 0.8182 | 1.0000 | 1.85e-14 | |
| 4 | 6b44:N | 41 | 31 | 0.7949 | 0.7561 | 1.0000 | 1.12e-11 | |
| 5 | 6lnb:N | 33 | 30 | 0.7692 | 0.9091 | 1.0000 | 4.01e-11 | |
| 6 | 7eqg:O | 29 | 29 | 0.7436 | 1.0000 | 1.0000 | 1.44e-10 |
umich.edu