acgacagataatttgtcactgtacactacgccttttgtggagatgtctaatatctacgttttaacagtggccttattaaa
tgacttctcaaccttcac
The query sequence (length=98) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8rdu:3 | 98 | 98 | 1.0000 | 1.0000 | 1.0000 | 1.85e-48 | |
| 2 | 8rkv:3 | 46 | 46 | 0.4694 | 1.0000 | 1.0000 | 1.49e-19 | |
| 3 | 8aa5:L | 44 | 43 | 0.4388 | 0.9773 | 1.0000 | 6.95e-18 | |
| 4 | 8ff5:N | 53 | 40 | 0.3980 | 0.7358 | 0.9750 | 5.41e-14 | |
| 5 | 8ff4:N | 85 | 40 | 0.3980 | 0.4588 | 0.9750 | 5.41e-14 | |
| 6 | 8fcu:N | 63 | 40 | 0.3980 | 0.6190 | 0.9750 | 5.41e-14 | |
| 7 | 8bd5:C | 41 | 35 | 0.3571 | 0.8537 | 1.0000 | 1.95e-13 | |
| 8 | 8rkt:3 | 32 | 32 | 0.3265 | 1.0000 | 1.0000 | 9.06e-12 | |
| 9 | 8yha:T | 47 | 31 | 0.3163 | 0.6596 | 1.0000 | 3.26e-11 | |
| 10 | 8fcj:N | 38 | 28 | 0.2857 | 0.7368 | 1.0000 | 1.52e-09 | |
| 11 | 8ea4:1 | 98 | 28 | 0.2857 | 0.2857 | 1.0000 | 1.52e-09 | |
| 12 | 8ea3:1 | 99 | 28 | 0.2857 | 0.2828 | 1.0000 | 1.52e-09 |
zhanggroup.org