Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>dna
aagggcgcctataaaagggggtgggggcgcgttcgtcctcagtcgcgatcgaacactcgagccgagcag

The query sequence (length=69) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 5iyc:Y 80 69 1.0000 0.8625 1.0000 1.71e-32 5iyd:Y
2 5iyb:Y 75 69 1.0000 0.9200 1.0000 1.71e-32
3 5iy7:Y 77 69 1.0000 0.8961 1.0000 1.71e-32
4 7egb:Y 69 69 1.0000 1.0000 1.0000 1.71e-32 7ena:Y, 7enc:Y
5 7egb:X 69 69 1.0000 1.0000 1.0000 1.71e-32 7ena:X, 7enc:X
6 7eg7:Y 71 69 1.0000 0.9718 1.0000 1.71e-32
7 7eg7:X 71 69 1.0000 0.9718 1.0000 1.71e-32
8 5fur:F 80 68 0.9855 0.8500 1.0000 6.16e-32 6mzm:U
9 5fur:E 80 68 0.9855 0.8500 1.0000 6.16e-32 6mzm:V
10 7eg9:Y 71 68 0.9855 0.9577 1.0000 6.16e-32
11 7eg9:X 71 68 0.9855 0.9577 1.0000 6.16e-32
12 5iy8:Y 83 69 0.9855 0.8193 0.9855 7.96e-31 5iy9:Y
13 5iy6:Y 65 64 0.9275 0.9846 1.0000 1.03e-29 6o9l:Y
14 5iy6:X 65 64 0.9275 0.9846 1.0000 1.03e-29 6o9l:X
15 7lbm:V 64 63 0.9130 0.9844 1.0000 3.70e-29
16 7lbm:U 64 63 0.9130 0.9844 1.0000 3.70e-29
17 7egj:Y 74 62 0.8986 0.8378 1.0000 1.33e-28
18 7egj:X 74 62 0.8986 0.8378 1.0000 1.33e-28
19 7egd:Y 72 61 0.8841 0.8472 1.0000 4.79e-28
20 7egd:X 72 61 0.8841 0.8472 1.0000 4.79e-28
21 5iya:Y 59 58 0.8406 0.9831 1.0000 2.23e-26
22 5iya:X 59 58 0.8406 0.9831 1.0000 2.23e-26
23 8gxq:Y 67 67 0.9130 0.9403 0.9403 3.73e-24 8gxs:Y
24 8gxq:X 67 67 0.9130 0.9403 0.9403 3.73e-24 8gxs:X
25 5iyb:X 75 71 0.8986 0.8267 0.8732 1.75e-17
26 5iy7:X 77 71 0.8986 0.8052 0.8732 1.75e-17
27 7nvt:T 50 44 0.5942 0.8200 0.9318 1.36e-13
28 7nvt:N 50 41 0.5652 0.7800 0.9512 1.36e-13
29 7nvs:T 49 44 0.5942 0.8367 0.9318 1.36e-13
30 7nvs:N 49 41 0.5652 0.7959 0.9512 1.36e-13
31 7nvr:T 64 44 0.5942 0.6406 0.9318 1.36e-13 7nvy:T, 7nvz:T
32 7nvr:N 64 41 0.5652 0.6094 0.9512 1.36e-13 7nvy:N, 7nvz:N
33 8byq:T 198 44 0.5942 0.2071 0.9318 1.36e-13 8bz1:T
34 8byq:N 198 41 0.5652 0.1970 0.9512 1.36e-13 8bz1:N
35 8bvw:T 206 44 0.5942 0.1990 0.9318 1.36e-13
36 8bvw:N 206 41 0.5652 0.1893 0.9512 1.36e-13
37 7egh:Y 45 34 0.4928 0.7556 1.0000 4.89e-13
38 7egh:X 45 34 0.4928 0.7556 1.0000 4.89e-13
39 5iyc:X 80 29 0.4203 0.3625 1.0000 2.95e-10 5iyd:X
40 5iy8:X 83 29 0.4203 0.3494 1.0000 2.95e-10 5iy9:X

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417