# | PDB (resolution) |
Site # |
RNA
sequence |
EC number |
GO terms |
UniProt | PubMed | Binding affinity |
---|---|---|---|---|---|---|---|---|
1 | 8jay:M (4.2) |
BS01 | >8jay:O (identical to 8ffi:C, 8ffi:G, 8ffi:J, 8ffi:O, 8j9p:E, 8j9p:G, 8jay:E, 8jay:G, 8jay:K, 8qlp:C, 8qlp:G, 8qlp:K, 8qlp:O, 8sp0:C, 8sp0:G, 8sp3:C, 8sp3:G, 8spo:G, 8spo:J, 8squ:C)ugacggcucuaaucuauuagu ..................... |
? | GO:0003676 ... | A0A1I7NFD7 | 37932527 | |
2 | 8jay:N (4.2) |
BS01 | >8jay:O (identical to 8ffi:C, 8ffi:G, 8ffi:J, 8ffi:O, 8j9p:E, 8j9p:G, 8jay:E, 8jay:G, 8jay:K, 8qlp:C, 8qlp:G, 8qlp:K, 8qlp:O, 8sp0:C, 8sp0:G, 8sp3:C, 8sp3:G, 8spo:G, 8spo:J, 8squ:C)ugacggcucuaaucuauuagu ..................... |
? | GO:0007165 ... | A0A1I7NFG5 | 37932527 |