# | PDB (resolution) |
Site # |
DNA
sequence |
EC number |
GO terms |
UniProt | PubMed | Binding affinity |
---|---|---|---|---|---|---|---|---|
1 | 8spo:I (2.98) |
BS02 | >8spo:K (identical to 8ffi:D, 8ffi:H, 8ffi:K, 8ffi:P, 8j9p:H, 8jay:H, 8jay:P, 8sp0:D, 8sp0:H, 8sp3:D, 8sp3:H, 8spo:H, 8squ:D)ctaatagattagagccgtca |
? | GO:0007165 ... | A0A316E683 | 37494956 | |
2 | 8spo:L (2.98) |
BS02 | >8spo:K (identical to 8ffi:D, 8ffi:H, 8ffi:K, 8ffi:P, 8j9p:H, 8jay:H, 8jay:P, 8sp0:D, 8sp0:H, 8sp3:D, 8sp3:H, 8spo:H, 8squ:D)ctaatagattagagccgtca |
? | GO:0003676 ... | A0A316E3U6 | 37494956 |