# | PDB (resolution) |
Site # |
DNA
sequence |
EC number |
GO terms |
UniProt | PubMed | Binding affinity |
---|---|---|---|---|---|---|---|---|
1 | 4x4b:A (2.8) |
BS01 | >4x4b:E (identical to 3clc:E, 4x4c:E, 4x4d:E, 4x4e:E, 4x4f:E, 4x4g:E, 4x4h:E, 4x4i:E)atgtgacttatagtccgtgtgattatagtcaacat |
? | GO:0003677 ... | Q8GGH0 | 25723923 | |
2 | 4x4b:B (2.8) |
BS01 | >4x4b:E (identical to 3clc:E, 4x4c:E, 4x4d:E, 4x4e:E, 4x4f:E, 4x4g:E, 4x4h:E, 4x4i:E)atgtgacttatagtccgtgtgattatagtcaacat |
? | GO:0003677 ... | Q8GGH0 | 25723923 | |
3 | 4x4b:C (2.8) |
BS01 | >4x4b:E (identical to 3clc:E, 4x4c:E, 4x4d:E, 4x4e:E, 4x4f:E, 4x4g:E, 4x4h:E, 4x4i:E)atgtgacttatagtccgtgtgattatagtcaacat |
? | GO:0003677 ... | Q8GGH0 | 25723923 | |
4 | 4x4b:D (2.8) |
BS01 | >4x4b:E (identical to 3clc:E, 4x4c:E, 4x4d:E, 4x4e:E, 4x4f:E, 4x4g:E, 4x4h:E, 4x4i:E)atgtgacttatagtccgtgtgattatagtcaacat |
? | GO:0003677 ... | Q8GGH0 | 25723923 |