Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
Download all results in tab-seperated text for 3 receptor-ligand interactions, whose format is explained at readme.txt.
  • Hover over PDB to view the title of the structure. Click PDB to view the structure at the RCSB PDB database. Resolution -1.00 means the resolution is unavailable, e.g., for NMR structures.
  • Click Site # to view the binding site structure. Hover over Site # to view the binding residues.
  • The sequence is converted from residues with experimentally determined coordinates in the structure; residues not observed in the 3D structure are excluded.
  • Hover over EC number to view the full name of enzymatic activity.
  • Hover over GO terms to view all GO terms.
  • Hover over UniProt to view the protein name.

    • Sort results by
    << < 1 > >>
    Go to page

    # PDB
    (resolution)     		Site
    #     		RNA
    sequence         		EC
    number     		GO
    terms     		UniProt PubMed Binding
    affinity
    1 5z3g:D
    (3.65)    		 BS01 >5z3g:C (identical to 7btb:6, 6elz:6, 6em1:6, 6em3:6, 6em4:6, 6em5:6, 3jct:6, 6m62:6, 7ohp:6, 7ohq:6, 7ohr:6, 7ohs:6, 7ohv:6, 7ohw:6, 7ohx:6, 6ylx:6, 6yly:6)
    ccuucucaaacauucuguuugguagugagugauacucuuuggaguuaacu
ugaaauugccuuaaa
......<<<<<.....>>>>>.....<<<<...<<<......>>>..>>>
>..............
    		 ? GO:0000463 ... P40693 29557065
    2 5z3g:E
    (3.65)    		 BS01 >5z3g:C (identical to 7btb:6, 6elz:6, 6em1:6, 6em3:6, 6em4:6, 6em5:6, 3jct:6, 6m62:6, 7ohp:6, 7ohq:6, 7ohr:6, 7ohs:6, 7ohv:6, 7ohw:6, 7ohx:6, 6ylx:6, 6yly:6)
    ccuucucaaacauucuguuugguagugagugauacucuuuggaguuaacu
ugaaauugccuuaaa
......<<<<<.....>>>>>.....<<<<...<<<......>>>..>>>
>..............
    		 ? GO:0000463 ... P53927 29557065
    3 5z3g:H
    (3.65)    		 BS01 >5z3g:C (identical to 7btb:6, 6elz:6, 6em1:6, 6em3:6, 6em4:6, 6em5:6, 3jct:6, 6m62:6, 7ohp:6, 7ohq:6, 7ohr:6, 7ohs:6, 7ohv:6, 7ohw:6, 7ohx:6, 6ylx:6, 6yly:6)
    ccuucucaaacauucuguuugguagugagugauacucuuuggaguuaacu
ugaaauugccuuaaa
......<<<<<.....>>>>>.....<<<<...<<<......>>>..>>>
>..............
    		 ? GO:0000462 ... P38779 29557065
    Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023)(download the PDF file).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417