.
# |
PDB (resolution) |
Site # |
RNA
sequence |
EC number |
GO terms |
UniProt |
PubMed |
Binding affinity |
1 |
7l20:6 (3.15) |
BS02 |
>7l20:B (identical to 7a5f:B3, 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 8k2b:L2, 7l08:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2)
agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>.. |
? |
GO:0005515 ... |
Q96DV4 |
34127662 |
|
2 |
7l20:8 (3.15) |
BS01 |
>7l20:B (identical to 7a5f:B3, 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 8k2b:L2, 7l08:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2)
agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>.. |
? |
GO:0003723 ... |
Q9NQ50 |
34127662 |
|
3 |
7l20:P (3.15) |
BS02 |
>7l20:B (identical to 7a5f:B3, 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 8k2b:L2, 7l08:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2)
agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>.. |
? |
GO:0003735 ... |
A8K9D2 |
34127662 |
|
4 |
7l20:f (3.15) |
BS02 |
>7l20:B (identical to 7a5f:B3, 7a5g:B3, 7a5h:B, 7a5i:B3, 7a5j:B, 7a5k:B3, 3j9m:B, 8k2a:L2, 8k2b:L2, 7l08:B, 6nu2:B, 6nu3:B, 7of0:B, 7of2:B, 7of3:B, 7of4:B, 7of5:B, 7of6:B, 7of7:B, 7oi6:B, 7oi7:B, 7oi8:B, 7oi9:B, 7oia:B, 7oib:B, 7oic:B, 7oid:B, 7oie:B, 5ool:B, 5oom:B, 7qh6:B, 7qh7:B, 8qu1:B, 8qu5:B, 6vlz:B, 6vmi:B, 8xt0:L2, 8xt1:L2, 8xt2:L2, 8xt3:L2)
agaguguagcuuaaaagcacccaacuuacacuuaggagauucaauugacg
cucuga
<<<<<...<<<....>>>.<<.<<.......>>.>>....<<<..>>>.>
>>>>.. |
? |
GO:0005515 ... |
Q96GC5 |
34127662 |
|