# | PDB (resolution) |
Site # |
RNA
sequence |
EC number |
GO terms |
UniProt | PubMed | Binding affinity |
---|---|---|---|---|---|---|---|---|
1 | 7ohs:G (4.38) |
BS03 | >7ohs:6 (identical to 7btb:6, 6elz:6, 6em1:6, 6em3:6, 6em4:6, 6em5:6, 3jct:6, 6m62:6, 7ohp:6, 7ohq:6, 7ohr:6, 7ohv:6, 7ohw:6, 7ohx:6, 6ylx:6, 6yly:6, 5z3g:C)ccuucucaaacauucuguuugguagugagugauacucuuuggaguuaacu ugaaauugccuuaaa ......<<<<<<...>>>>>>.....<<<<...<<<<....>>>>..>>> >.............. |
? | GO:0000470 ... | P17076 | 34813592 | |
2 | 7ohs:K (4.38) |
BS01 | >7ohs:6 (identical to 7btb:6, 6elz:6, 6em1:6, 6em3:6, 6em4:6, 6em5:6, 3jct:6, 6m62:6, 7ohp:6, 7ohq:6, 7ohr:6, 7ohv:6, 7ohw:6, 7ohx:6, 6ylx:6, 6yly:6, 5z3g:C)ccuucucaaacauucuguuugguagugagugauacucuuuggaguuaacu ugaaauugccuuaaa ......<<<<<<...>>>>>>.....<<<<...<<<<....>>>>..>>> >.............. |
? | GO:0000462 ... | P38779 | 34813592 | |
3 | 7ohs:o (4.38) |
BS01 | >7ohs:6 (identical to 7btb:6, 6elz:6, 6em1:6, 6em3:6, 6em4:6, 6em5:6, 3jct:6, 6m62:6, 7ohp:6, 7ohq:6, 7ohr:6, 7ohv:6, 7ohw:6, 7ohx:6, 6ylx:6, 6yly:6, 5z3g:C)ccuucucaaacauucuguuugguagugagugauacucuuuggaguuaacu ugaaauugccuuaaa ......<<<<<<...>>>>>>.....<<<<...<<<<....>>>>..>>> >.............. |
? | GO:0000463 ... | P53927 | 34813592 | |
4 | 7ohs:t (4.38) |
BS02 | >7ohs:6 (identical to 7btb:6, 6elz:6, 6em1:6, 6em3:6, 6em4:6, 6em5:6, 3jct:6, 6m62:6, 7ohp:6, 7ohq:6, 7ohr:6, 7ohv:6, 7ohw:6, 7ohx:6, 6ylx:6, 6yly:6, 5z3g:C)ccuucucaaacauucuguuugguagugagugauacucuuuggaguuaacu ugaaauugccuuaaa ......<<<<<<...>>>>>>.....<<<<...<<<<....>>>>..>>> >.............. |
? | GO:0000463 ... | P40693 | 34813592 |