aucgaaucgccaccuacaagacuggagcuugcucccucgaaggcgccaaguauauucaugaucacaagaca
The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8a98:6 | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 2.44e-32 | 6az3:6, 8ovj:6, 8rxh:L6, 8rxx:L6 |
| 2 | 5t2a:F | 71 | 69 | 0.9718 | 0.9718 | 1.0000 | 3.16e-31 | |
| 3 | 3jcs:6 | 61 | 59 | 0.8310 | 0.9672 | 1.0000 | 1.14e-25 | |
| 4 | 8a3w:6 | 63 | 70 | 0.8873 | 1.0000 | 0.9000 | 6.93e-18 |
zhanggroup.org