BioLiP
Structure of PDB 4gkj Chain Q Binding Site BS01
>4gkj Chain A (length=1513)
[Search RNA sequence ]
[Download ligand structure ]
[Download structure with residue number starting from 1 ]
[View ligand structure ]
uggagaguuugauccuggcucagggugaacgcuggcggcgugccuaagac ....<<<<..[.((((.>>>>.<<<<.<<<<<..<<<<<<<<..<..<<<
UnboundLocalError Python 3.6.8: /usr/bin/python3
A problem occurred in a Python script. Here is the sequence of
function calls leading up to the error, in the order they occurred.
/var/www/html/BioLiP/pdb.cgi in <module> () 1701 title=pdb2title(pdbid) 1702 if bs.startswith("BS"): => 1703 pubmed,uniprot=display_interaction(pdbid,asym_id,bs,title) 1704 else: 1705 if lig3: pubmed = '', uniprot = '', display_interaction = <function display_interaction>, pdbid = '4gkj', asym_id = 'Q', bs = 'BS01', title = 'Expanded use of sense codons is regulated by modified cytidines in tRNA.'
/var/www/html/BioLiP/pdb.cgi in display_interaction (pdbid='4gkj', asym_id='Q', bs='BS01', title='Expanded use of sense codons is regulated by modified cytidines in tRNA.') 1326 display_ec(ec,csaOrig,csaRenu) 1327 if go: => 1328 display_go(go,uniprot,pdbid,asym_id) 1329 return pubmed,uniprot 1330 global display_go = <function display_go>, go = '0003735,0005840,0006412', uniprot = '', pdbid = '4gkj', asym_id = 'Q'
/var/www/html/BioLiP/pdb.cgi in display_go (go='0003735,0005840,0006412', uniprot='', pdbid='4gkj', asym_id='Q') 484 '''.replace("$namespace_link",namespace_link 485 ).replace("$namespace",namespace => 486 ).replace("$uniprot",u 487 )) 488 for l,(term,name) in enumerate(go2aspect[Aspect]): u undefined
UnboundLocalError : local variable 'u' referenced before assignment
