Structure of PDB 1hc8 Chain B Binding Site BS01

Receptor Information
>1hc8 Chain B (length=70) Species: 1422 (Geobacillus stearothermophilus) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]
KTPPAAVLLKKAAGIESGSGEPNRNKVATIKRDKVREIAELKMPDLNAAS
IEAAMRMIEGTARSMGIVVE
Ligand information
>1hc8 Chain D (length=58) [Search RNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]
gccaggauguaggcuuagaagcagccaucauuuaaagaaagcguaauagc
ucacuggu
<<<<<.<<...<<<<.......>>>>...>>........<<<......>>
>..>>>>>
Receptor-Ligand Complex Structure
Global viewLocal viewStructure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]
PDB1hc8 A Compact RNA Tertiary Structure Contains a Buried Backbone-K+ Complex
Resolution2.8 Å
Binding residue
(original residue number in PDB)		K206 P209 A210 K215 S222 G223 S224 G225 E226 P227 N228 R229 N252 A258 R261 M262 G265 T266 R268 S269 M270
Binding residue
(residue number reindexed from 1)		K1 P4 A5 K10 S17 G18 S19 G20 E21 P22 N23 R24 N47 A53 R56 M57 G60 T61 R63 S64 M65
Enzymatic activity
Enzyme Commision number ?
Gene Ontology
Molecular Function
GO:0003735 structural constituent of ribosome
Biological Process
GO:0006412 translation
Cellular Component
GO:0005840 ribosome

View graph for
Molecular Function
View graph for
Biological Process
View graph for
Cellular Component
External links
PDB RCSB:1hc8, PDBe:1hc8, PDBj:1hc8
PDBsum1hc8
PubMed12054794
UniProtP56210|RL11_GEOSE Large ribosomal subunit protein uL11 (Fragment) (Gene Name=rplK)

[Back to BioLiP]