Input Sequence in FASTA format
>6q8y_n_1_73 (73 residues)
UUCCUCGUGGCCCAAUGGUCACGGCGUCUGGCUACGAACCAGAAGAUUCCAGGUUCAAGU
CCUGGCGGGGAAG
|
Sequence Profile
Predicted Distance and Orientation Maps
Distance Map
|
Orientation Map
|
|
| The DeepFoldRNA simulations are guided by the consensus distance (left figure) and
orientation maps (right figure). In the distance and orientation maps, the axes mark the
residue index along the sequence and the color scale represents a distance of 2-40+ Angstroms
or an angle of 0-360 Degrees, respectively.
|
| References: |
| 1. | Robin Pearce, Gilbert S. Omenn, Yang Zhang. De novo RNA tertiary structure prediction at atomic resolution using geometric potentials from deep learning. BioRxiv (2022). |
