BioLiP

>rna
uuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaa

The query sequence (length=58) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6zym:5	74	58	1.0000	0.7838	1.0000	3.17e-25
2	7w59:B	84	58	1.0000	0.6905	1.0000	3.17e-25	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
3	8r09:5	112	58	1.0000	0.5179	1.0000	3.17e-25	8r0b:5, 8rm5:5
4	8qzs:5	109	58	1.0000	0.5321	1.0000	3.17e-25	8y6o:B
5	8qpk:5	77	58	1.0000	0.7532	1.0000	3.17e-25
6	8qoz:5	79	58	1.0000	0.7342	1.0000	3.17e-25	8qpa:5, 8qpb:5
7	6qdv:5	75	58	1.0000	0.7733	1.0000	3.17e-25
8	6id0:B	98	58	1.0000	0.5918	1.0000	3.17e-25	6id1:B
9	6icz:B	97	58	1.0000	0.5979	1.0000	3.17e-25
10	8i0p:B	98	58	1.0000	0.5918	1.0000	3.17e-25	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
11	8h6e:5A	114	58	1.0000	0.5088	1.0000	3.17e-25	8h6j:5A
12	9fmd:5	92	58	1.0000	0.6304	1.0000	3.17e-25	8ro2:5
13	6ff4:5	70	58	1.0000	0.8286	1.0000	3.17e-25	6ff7:5
14	7dvq:B	90	58	1.0000	0.6444	1.0000	3.17e-25
15	8ch6:e	98	58	1.0000	0.5918	1.0000	3.17e-25	7qtt:e
16	8c6j:5	113	58	1.0000	0.5133	1.0000	3.17e-25
17	6ah0:B	115	58	1.0000	0.5043	1.0000	3.17e-25	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
18	7abg:5	114	58	1.0000	0.5088	1.0000	3.17e-25	7abi:5, 5mqf:5, 5o9z:5
19	7abf:5	58	58	1.0000	1.0000	1.0000	3.17e-25
20	7aav:5	69	58	1.0000	0.8406	1.0000	3.17e-25
21	8qp8:5	71	58	0.9138	0.7465	0.9138	3.22e-15	8qp9:5
22	8q7q:5	104	58	0.9138	0.5096	0.9138	3.22e-15	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
23	8ro1:5	111	39	0.6379	0.3333	0.9487	2.50e-11
24	8ro0:5	111	39	0.6379	0.3333	0.9487	2.50e-11

[Back]