uuuccuugaagcuuucgugcugacccugucccuuuuuuuuccuaccaggugaguaug
The query sequence (length=57) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8h6l:A | 57 | 57 | 1.0000 | 1.0000 | 1.0000 | 1.11e-24 | |
| 2 | 8h6e:A | 59 | 57 | 0.9825 | 0.9492 | 0.9825 | 1.86e-22 | |
| 3 | 8h6k:A | 64 | 61 | 1.0000 | 0.8906 | 0.9344 | 4.03e-19 | |
| 4 | 8h6j:A | 42 | 42 | 0.7368 | 1.0000 | 1.0000 | 2.42e-16 |
umich.edu