uuguacaguuugaggguauaugauacaacccgguacaggagauaacuguacagg
The query sequence (length=54) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8opt:D | 54 | 54 | 1.0000 | 1.0000 | 1.0000 | 4.78e-23 | |
| 2 | 8ost:C | 69 | 54 | 0.9815 | 0.7681 | 0.9815 | 2.22e-21 |
umich.edu