BioLiP

>rna
uuggaacgauacagagaagauuagcauggccccugcgcaaggaugacauucgugaagcguauuuu

The query sequence (length=65) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	8r09:6	65	65	1.0000	1.0000	1.0000	4.68e-29	8r0b:6
2	8rm5:6	64	64	0.9846	1.0000	1.0000	1.68e-28
3	6ahd:F	94	64	0.9846	0.6809	1.0000	1.68e-28	8qo9:6
4	5o9z:6	90	60	0.9231	0.6667	1.0000	2.81e-26
5	8h6k:6A	60	60	0.9231	1.0000	1.0000	2.81e-26
6	8h6e:6A	59	59	0.9077	1.0000	1.0000	1.01e-25	8h6l:6A, 8qzs:6
7	5z56:F	93	62	0.9231	0.6452	0.9677	1.69e-23	5z57:F, 5z58:F
8	8ch6:d	93	62	0.9077	0.6344	0.9516	7.88e-22	7qtt:d
9	6zym:6	79	48	0.7385	0.6076	1.0000	1.32e-19
10	8qoz:6	48	48	0.7385	1.0000	1.0000	1.32e-19	8qpb:6
11	8q7n:6	78	48	0.7385	0.6154	1.0000	1.32e-19
12	8h6j:6A	54	51	0.7692	0.9259	0.9804	1.32e-19
13	6ff4:6	95	48	0.7385	0.5053	1.0000	1.32e-19	6ff7:6, 8i0p:F
14	8c6j:6	97	48	0.7385	0.4948	1.0000	1.32e-19	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
15	8qpa:6	47	47	0.7231	1.0000	1.0000	4.74e-19
16	8r0a:6	59	57	0.8308	0.9153	0.9474	1.71e-18
17	8ro1:6	101	48	0.7231	0.4653	0.9792	6.13e-18
18	8ro0:6	90	48	0.7231	0.5222	0.9792	6.13e-18
19	5mqf:6	89	44	0.6769	0.4944	1.0000	2.21e-17
20	6ah0:F	69	54	0.7846	0.7391	0.9444	2.21e-17
21	8qpe:6	43	43	0.6615	1.0000	1.0000	7.94e-17
22	6qx9:6	53	52	0.7538	0.9245	0.9423	2.85e-16	8qxd:6, 8r08:6
23	3jb9:N	90	48	0.7077	0.5111	0.9583	2.85e-16
24	8qpk:6	43	38	0.5846	0.8837	1.0000	4.78e-14
25	6qw6:6	42	37	0.5538	0.8571	0.9730	7.99e-12
26	8qp8:6	37	34	0.5077	0.8919	0.9706	3.72e-10	8qp9:6

[Back]