uugcguugauaaaaguauuguuuuuguacucuagaagcuacaaagauaaggcuucaugccgaaaucaacaccgguguu
The query sequence (length=78) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6rj9:D | 78 | 78 | 1.0000 | 1.0000 | 1.0000 | 3.56e-36 | 6rja:D, 6rja:G, 6rjd:D, 6rjg:D |
| 2 | 6m0w:B | 72 | 51 | 0.6154 | 0.6667 | 0.9412 | 1.32e-15 | |
| 3 | 6m0v:B | 71 | 51 | 0.6154 | 0.6761 | 0.9412 | 1.32e-15 | 6m0x:B |
umich.edu