uugaugucacggaaccuuuguugucuucgacauggguaa
The query sequence (length=39) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8wmi:R | 39 | 39 | 1.0000 | 1.0000 | 1.0000 | 6.07e-15 | |
| 2 | 7wah:R | 39 | 38 | 0.9744 | 0.9744 | 1.0000 | 2.18e-14 | |
| 3 | 8eey:C | 38 | 38 | 0.9744 | 1.0000 | 1.0000 | 2.18e-14 | 8gs2:R, 8wm4:R, 8wmc:R, 8wml:R, 7y9x:R, 7y9y:R |
| 4 | 8eex:C | 36 | 36 | 0.9231 | 1.0000 | 1.0000 | 2.83e-13 |
umich.edu