uucuccagugagacgaaaaccaaugccuucacuggcaguaacacccagcuuccugaacgcaugucaugcaugccagguuu
uguugguu
The query sequence (length=88) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5osg:2 | 88 | 88 | 1.0000 | 1.0000 | 1.0000 | 1.15e-41 | |
| 2 | 5t2a:2 | 1814 | 34 | 0.3864 | 0.0187 | 1.0000 | 1.20e-11 |
umich.edu