uuccucguggcccaauggucacggcgucuggcuucgaaccagaagauuccagguucaaguccuggcggggaagcca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7rr5:P | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 7zpq:6, 7zs5:2, 7zuw:6 |
2 | 1f7u:B | 76 | 76 | 0.9868 | 0.9868 | 0.9868 | 2.07e-33 | 6i7o:n, 7r81:t1, 7r81:u1, 6snt:6, 6sv4:n, 6t4q:6, 6t7i:6 |
3 | 1f7v:B | 73 | 73 | 0.9474 | 0.9863 | 0.9863 | 9.63e-32 |