Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
ugugguggcgauagcgagaaggauacaccuguucccaugccgaacacagaaguuaagcuucuuagcgccgauuguaguga
aggguuucccuuugugagaguaggacgucgccacgc

The query sequence (length=116) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 6o8w:B 116 116 1.0000 1.0000 1.0000 4.40e-57 6o8x:B, 6o8y:B, 6o8z:B, 6o90:B, 6w6p:B, 6wu9:B
2 7nhk:B 114 114 0.9828 1.0000 1.0000 5.69e-56 7p7q:B, 7p7r:B, 7p7s:B, 7p7t:B, 7p7u:B
3 6wru:2 112 76 0.5776 0.5982 0.8816 7.73e-20
4 6wqn:2 111 76 0.5776 0.6036 0.8816 7.73e-20 6wqq:2, 6wrs:2
5 7ttu:2 111 80 0.6034 0.6306 0.8750 7.73e-20 7ttw:2
6 5t7v:C 114 76 0.5776 0.5877 0.8816 7.73e-20
7 6s0z:B 114 80 0.6034 0.6140 0.8750 7.73e-20
8 7nhl:B 113 80 0.6034 0.6195 0.8750 7.73e-20 7nhm:B, 8p2f:B, 8p2g:B, 8p2h:B, 7p48:B
9 7asm:B 115 80 0.6034 0.6087 0.8750 7.73e-20 6fxc:AB, 6fxc:BB, 6hma:B, 5ngm:AB, 6s0x:B, 6s12:B, 6s13:B, 8y36:B, 8y37:B, 8y38:B, 8y39:B, 6yef:B
10 6ddd:2 104 78 0.5862 0.6538 0.8718 1.00e-18 6ddg:2
11 7aso:C 114 75 0.5517 0.5614 0.8533 6.02e-16 7asp:3, 5hkv:Y, 5hl7:Y, 5li0:B, 5nd8:B, 5nd9:B, 5nrg:Y, 5tcu:C, 4wce:Y, 4wf9:Y, 4wfa:Y, 4wfb:Y

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218