BioLiP

>rna
ugguuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaacucug

The query sequence (length=69) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6zym:5	74	69	1.0000	0.9324	1.0000	3.04e-31
2	8r09:5	112	69	1.0000	0.6161	1.0000	3.04e-31	8r0b:5, 8rm5:5
3	8qzs:5	109	69	1.0000	0.6330	1.0000	3.04e-31	8y6o:B
4	8qpk:5	77	69	1.0000	0.8961	1.0000	3.04e-31
5	8qoz:5	79	69	1.0000	0.8734	1.0000	3.04e-31	8qpa:5, 8qpb:5
6	6id0:B	98	69	1.0000	0.7041	1.0000	3.04e-31	6id1:B
7	8h6e:5A	114	69	1.0000	0.6053	1.0000	3.04e-31	8h6j:5A
8	8c6j:5	113	69	1.0000	0.6106	1.0000	3.04e-31
9	6ah0:B	115	69	1.0000	0.6000	1.0000	3.04e-31	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
10	7abg:5	114	69	1.0000	0.6053	1.0000	3.04e-31	7abi:5, 5mqf:5, 5o9z:5
11	7aav:5	69	69	1.0000	1.0000	1.0000	3.04e-31
12	6icz:B	97	68	0.9855	0.7010	1.0000	1.09e-30
13	6ff4:5	70	68	0.9855	0.9714	1.0000	1.09e-30	6ff7:5
14	7w59:B	84	64	0.9275	0.7619	1.0000	1.83e-28	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
15	8i0p:B	98	64	0.9275	0.6531	1.0000	1.83e-28	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
16	7dvq:B	90	64	0.9275	0.7111	1.0000	1.83e-28
17	8ch6:e	98	68	0.9710	0.6837	0.9853	1.83e-28	7qtt:e
18	6qdv:5	75	63	0.9130	0.8400	1.0000	6.57e-28
19	9fmd:5	92	61	0.8841	0.6630	1.0000	8.50e-27	8ro2:5
20	7abf:5	58	58	0.8406	1.0000	1.0000	3.96e-25
21	8qp8:5	71	69	0.9275	0.9014	0.9275	3.08e-21	8qp9:5
22	8q7q:5	104	69	0.9275	0.6154	0.9275	3.08e-21	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
23	8ro1:5	111	39	0.5362	0.3333	0.9487	3.12e-11
24	8ro0:5	111	39	0.5362	0.3333	0.9487	3.12e-11

[Back]