ugggaggucgucuaacgguaggacggcggacucuugauccgcugguggagguucgaguccuccccucccag
The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4yvj:C | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 2.44e-32 | |
| 2 | 4yvk:C | 71 | 71 | 0.9859 | 0.9859 | 0.9859 | 1.14e-30 | |
| 3 | 4yvi:C | 71 | 71 | 0.9859 | 0.9859 | 0.9859 | 1.14e-30 | |
| 4 | 3akz:F | 74 | 71 | 0.9859 | 0.9459 | 0.9859 | 1.14e-30 | 3akz:H, 3akz:G, 3akz:E, 3al0:E |
umich.edu