uggccggcauggucccagccuccucgcuggcgccggcugggcaacaccauugcacuccgguggugaaugggac
The query sequence (length=73) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4prf:B | 74 | 73 | 1.0000 | 0.9865 | 1.0000 | 1.96e-33 | 1sjf:B |
| 2 | 2oih:B | 73 | 73 | 1.0000 | 1.0000 | 1.0000 | 1.96e-33 | 2oj3:B, 1sj3:R, 1sj4:R, 1vbx:B, 1vby:B, 1vbz:B, 1vc0:B |
| 3 | 1vc6:B | 72 | 72 | 0.9863 | 1.0000 | 1.0000 | 7.05e-33 | |
| 4 | 1drz:B | 72 | 72 | 0.9726 | 0.9861 | 0.9861 | 3.28e-31 | 4pr6:B |
| 5 | 1vc5:B | 70 | 72 | 0.9452 | 0.9857 | 0.9583 | 2.55e-27 |
umich.edu