BioLiP

>rna
uggaacgauacagagaagauuagcauggccccugcgcaaggaugaca

The query sequence (length=47) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6zym:6	79	47	1.0000	0.5949	1.0000	3.00e-19
2	5z56:F	93	47	1.0000	0.5054	1.0000	3.00e-19	5z57:F, 5z58:F
3	8rm5:6	64	47	1.0000	0.7344	1.0000	3.00e-19
4	8r09:6	65	47	1.0000	0.7231	1.0000	3.00e-19	8r0b:6
5	8qpa:6	47	47	1.0000	1.0000	1.0000	3.00e-19
6	8qoz:6	48	47	1.0000	0.9792	1.0000	3.00e-19	8qpb:6
7	8q7n:6	78	47	1.0000	0.6026	1.0000	3.00e-19
8	5o9z:6	90	47	1.0000	0.5222	1.0000	3.00e-19
9	6ff4:6	95	47	1.0000	0.4947	1.0000	3.00e-19	6ff7:6, 8i0p:F
10	8ch6:d	93	47	1.0000	0.5054	1.0000	3.00e-19	7qtt:d
11	8c6j:6	97	47	1.0000	0.4845	1.0000	3.00e-19	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
12	6ahd:F	94	47	1.0000	0.5000	1.0000	3.00e-19	8qo9:6
13	8ro1:6	101	47	0.9787	0.4554	0.9787	1.39e-17
14	8ro0:6	90	47	0.9787	0.5111	0.9787	1.39e-17
15	5mqf:6	89	44	0.9362	0.4944	1.0000	1.39e-17
16	8h6k:6A	60	44	0.9362	0.7333	1.0000	1.39e-17
17	8qpe:6	43	43	0.9149	1.0000	1.0000	5.01e-17
18	8h6e:6A	59	43	0.9149	0.7288	1.0000	5.01e-17	8h6l:6A, 8qzs:6
19	3jb9:N	90	47	0.9574	0.5000	0.9574	6.48e-16
20	8r0a:6	59	38	0.8085	0.6441	1.0000	3.02e-14
21	8qpk:6	43	38	0.8085	0.8837	1.0000	3.02e-14
22	6qw6:6	42	35	0.7234	0.8095	0.9714	6.53e-11
23	8h6j:6A	54	35	0.7234	0.6296	0.9714	6.53e-11
24	6ah0:F	69	35	0.7234	0.4928	0.9714	6.53e-11
25	6qx9:6	53	34	0.7021	0.6226	0.9706	2.35e-10	8qxd:6, 8r08:6
26	8qp8:6	37	34	0.7021	0.8919	0.9706	2.35e-10	8qp9:6

[Back]