ugcgcacccuuagcgagaggccucuggauguugcggcauccugcauugaaucugaguuacu
The query sequence (length=61) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8qbk:C | 61 | 61 | 1.0000 | 1.0000 | 1.0000 | 7.33e-27 | 8qbk:M, 8qbk:R, 8qbk:W, 8qbl:C, 8qbl:O, 8qbl:W, 8qbl:b, 8qbl:R, 8qbm:C, 8qbm:M, 8qbm:O, 8qbm:R, 8qbm:W, 8qbm:b |
| 2 | 8qbl:M | 58 | 58 | 0.9508 | 1.0000 | 1.0000 | 3.41e-25 |
umich.edu