BioLiP

>rna
ugcgaaagcaguugaagacaaguggcuugucguucguuaaaauggccucgucaaacggugguacagcguguuuaauugac
auggguugauaaccugaacagucucaucguggccauuggugagcagcgaaggauuugguggauuacuagcuaauagcaau
cuauuucaaagaauucaaacuugggggaaugccuuguugaauagccggucgcaagacugugauucuucaaguguaaccuc
cucucuaucaaacguaccgguaucuguuuggugggaaacucaaagagugcuaugguauggugacggagugcgcuggucaa
gaguguaaaagcuuuuugaacagagagcauuuccggcagcagagauuucagcugu

The query sequence (length=375) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6lqq:5A	375	375	1.0000	1.0000	1.0000	0.0
2	7suk:L0	488	288	0.6453	0.4959	0.8403	1.58e-66	5wlc:L0
3	7suk:L0	488	29	0.0773	0.0594	1.0000	3.69e-08	5wlc:L0
4	6zqb:D2	522	133	0.3547	0.2548	1.0000	5.67e-66
5	6zqb:D2	522	102	0.2720	0.1954	1.0000	9.69e-49
6	6zqb:D2	522	61	0.1600	0.1149	0.9836	1.00e-23
7	6zqb:D2	522	29	0.0773	0.0556	1.0000	3.69e-08
8	6zqa:D2	523	133	0.3547	0.2543	1.0000	5.67e-66
9	6zqa:D2	523	102	0.2720	0.1950	1.0000	9.69e-49
10	6zqa:D2	523	61	0.1600	0.1147	0.9836	1.00e-23
11	6zqa:D2	523	29	0.0773	0.0554	1.0000	3.69e-08
12	6ke6:5A	522	133	0.3547	0.2548	1.0000	5.67e-66
13	6ke6:5A	522	102	0.2720	0.1954	1.0000	9.69e-49
14	6ke6:5A	522	61	0.1600	0.1149	0.9836	1.00e-23
15	6ke6:5A	522	29	0.0773	0.0556	1.0000	3.69e-08
16	7d5s:5A	523	133	0.3547	0.2543	1.0000	5.67e-66	6lqp:5A, 6lqu:5A
17	7d5s:5A	523	102	0.2720	0.1950	1.0000	9.69e-49	6lqp:5A, 6lqu:5A
18	7d5s:5A	523	61	0.1627	0.1166	1.0000	6.00e-26	6lqp:5A, 6lqu:5A
19	7d5s:5A	523	29	0.0773	0.0554	1.0000	3.69e-08	6lqp:5A, 6lqu:5A
20	7ajt:D2	446	133	0.3547	0.2982	1.0000	5.67e-66	6zqc:D2
21	7ajt:D2	446	61	0.1600	0.1345	0.9836	1.00e-23	6zqc:D2
22	7ajt:D2	446	29	0.0773	0.0650	1.0000	3.69e-08	6zqc:D2
23	6nd4:0	408	293	0.6453	0.5931	0.8259	1.60e-56
24	6nd4:0	408	29	0.0773	0.0711	1.0000	3.69e-08
25	7d63:5A	192	102	0.2720	0.5312	1.0000	9.69e-49	6lqr:5A
26	7d63:5A	192	52	0.1333	0.2604	0.9615	4.70e-17	6lqr:5A
27	7d63:5A	192	40	0.1067	0.2083	1.0000	2.83e-14	6lqr:5A
28	5wyj:5A	462	202	0.4533	0.3680	0.8416	7.54e-45	5wyk:5A
29	5wyj:5A	462	62	0.1467	0.1190	0.8871	1.32e-12	5wyk:5A
30	7d4i:5A	118	52	0.1387	0.4407	1.0000	6.04e-21
31	7aju:D2	81	52	0.1360	0.6296	0.9808	1.01e-18	6zqd:D2, 6zqe:D2
32	6lqv:5A	171	52	0.1333	0.2924	0.9615	4.70e-17
33	6lqv:5A	171	42	0.1120	0.2456	1.0000	2.19e-15
34	6lqv:5A	171	40	0.1067	0.2339	1.0000	2.83e-14
35	6lqv:5A	171	39	0.1040	0.2281	1.0000	1.02e-13
36	6lqs:5A	152	50	0.1280	0.3158	0.9600	6.08e-16	6lqt:5A
37	6lqs:5A	152	41	0.1093	0.2697	1.0000	7.87e-15	6lqt:5A
38	6lqs:5A	152	33	0.0880	0.2171	1.0000	2.20e-10	6lqt:5A

[Back]