ugaaggccuguuuccuaggcuacauacgagggaccgcaccaaccacacggggcucauucucagcgc
The query sequence (length=66) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7das:C | 66 | 66 | 1.0000 | 1.0000 | 1.0000 | 1.33e-29 | |
| 2 | 7da7:C | 90 | 34 | 0.5152 | 0.3778 | 1.0000 | 8.17e-12 | |
| 3 | 7da7:C | 90 | 30 | 0.4545 | 0.3333 | 1.0000 | 1.37e-09 |
umich.edu