ucuucgguaguauaguggucaguauccccgccugucacgcgggagaccgggguucgauuccccgccggagagcca
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8h8e:G | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | |
| 2 | 8jdj:B | 75 | 75 | 0.9333 | 0.9333 | 0.9333 | 3.43e-26 | 8jdk:B, 7y7c:V, 7y7d:V, 7y7e:V, 7y7f:V |
| 3 | 8omr:C | 75 | 65 | 0.8267 | 0.8267 | 0.9538 | 5.73e-24 |
umich.edu