ucuguuuaccaggucagguccggaaggaagcagccaaggcaga
The query sequence (length=43) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5nco:1 | 104 | 43 | 1.0000 | 0.4135 | 1.0000 | 4.32e-17 | |
| 2 | 5gad:1 | 43 | 43 | 1.0000 | 1.0000 | 1.0000 | 4.32e-17 | 5gaf:1, 5gag:1, 5gah:1 |
umich.edu