ucggcggugggggagcaucuccuguaggggagauguaacccccuuuaccugccgaaccccgccaggcccggaagggagca
acgguaggcaggacguc
The query sequence (length=97) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 3ndb:M | 136 | 97 | 1.0000 | 0.7132 | 1.0000 | 1.29e-46 | |
| 2 | 1lng:B | 97 | 97 | 1.0000 | 1.0000 | 1.0000 | 1.29e-46 | |
| 3 | 2v3c:M | 96 | 95 | 0.9794 | 0.9896 | 1.0000 | 1.67e-45 | 2v3c:N, 4xco:M, 4xco:E |
umich.edu