ucgaaucgccacuucucuuauccggugggcugcccgcccggcgcccaguaccuucauuuucacaagauc
The query sequence (length=69) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8ova:BF | 69 | 69 | 1.0000 | 1.0000 | 1.0000 | 3.04e-31 | 8ove:BF |
| 2 | 4v8m:BF | 73 | 73 | 0.9275 | 0.8767 | 0.8767 | 8.63e-17 |
umich.edu