uccgagccgguugucgcgcgguucaaucccuggugcgggugcuaguaccggcuccgcacuaucuauaggu
The query sequence (length=70) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 9cex:W | 75 | 70 | 1.0000 | 0.9333 | 1.0000 | 8.61e-32 | |
| 2 | 9cew:W | 76 | 70 | 1.0000 | 0.9211 | 1.0000 | 8.61e-32 | 9cey:W, 9cez:W |
| 3 | 9cev:W | 81 | 70 | 1.0000 | 0.8642 | 1.0000 | 8.61e-32 | |
| 4 | 9ceu:W | 70 | 70 | 1.0000 | 1.0000 | 1.0000 | 8.61e-32 | |
| 5 | 8gkh:W | 76 | 70 | 0.9857 | 0.9079 | 0.9857 | 4.01e-30 |
umich.edu