uauugacgaccccgauugguucuacuacaguuuc
The query sequence (length=34) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8s9v:G | 34 | 34 | 1.0000 | 1.0000 | 1.0000 | 2.96e-12 | |
| 2 | 8s9t:F | 37 | 34 | 1.0000 | 0.9189 | 1.0000 | 2.96e-12 | 8s9u:F, 8s9v:F, 8s9x:F |
| 3 | 8s9u:G | 33 | 29 | 0.8529 | 0.8788 | 1.0000 | 1.78e-09 |
umich.edu