uauucugguguccuaggcguagaggaaccacaccaauccaucccgaacuuggugguuaaacucuacugcggugacgauac
uguaggggagguccugcggaaaaauagcucgacgccaggau
The query sequence (length=121) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5mmi:B | 121 | 121 | 1.0000 | 1.0000 | 1.0000 | 7.68e-60 | 5mmm:B |
| 2 | 5mlc:B | 120 | 120 | 0.9917 | 1.0000 | 1.0000 | 2.76e-59 | |
| 3 | 6eri:Ax | 118 | 118 | 0.9752 | 1.0000 | 1.0000 | 3.57e-58 | |
| 4 | 5h1s:B | 117 | 117 | 0.9669 | 1.0000 | 1.0000 | 1.29e-57 | 4v61:BB, 5x8p:B, 5x8t:B |
umich.edu