BioLiP

>rna
uaguaucuguucuuaucaguuuaauaucugauuccucgaggaggauuuuuggagcagggagauggaauaggagcuugcuc
cguccacuccacgcaucgaccugguauugcaguaccuccaggaacggugc

The query sequence (length=130) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7vpx:H	130	130	1.0000	1.0000	1.0000	8.21e-65
2	7evo:H	148	130	1.0000	0.8784	1.0000	8.21e-65	8hk1:H, 6y5q:2
3	7abi:2	164	133	1.0000	0.7927	0.9774	2.30e-60
4	8i0r:H	167	134	1.0000	0.7784	0.9701	2.97e-59	8i0s:H, 8i0t:H, 8i0u:H
5	8i0p:H	165	134	1.0000	0.7879	0.9701	2.97e-59
6	7abg:2	145	132	0.9769	0.8759	0.9621	1.79e-56
7	6y53:2	98	98	0.7538	1.0000	1.0000	5.05e-47
8	8i0v:H	151	130	0.9077	0.7815	0.9077	1.83e-41
9	7a5p:2	155	88	0.6769	0.5677	1.0000	1.83e-41
10	5z56:H	136	65	0.4692	0.4485	0.9385	6.76e-21	5z57:H, 5z58:H
11	5z56:H	136	42	0.3231	0.3088	1.0000	6.81e-16	5z57:H, 5z58:H
12	8ch6:f	137	65	0.4692	0.4453	0.9385	6.76e-21
13	8ch6:f	137	42	0.3231	0.3066	1.0000	6.81e-16
14	5mqf:2	140	49	0.3769	0.3500	1.0000	8.75e-20
15	8c6j:2	142	49	0.3769	0.3451	1.0000	8.75e-20
16	5o9z:2	100	48	0.3692	0.4800	1.0000	3.15e-19
17	6icz:H	140	42	0.3231	0.3000	1.0000	6.81e-16	7w59:H, 7w5a:H, 7w5b:H, 5xjc:H
18	8i0w:H	139	42	0.3231	0.3022	1.0000	6.81e-16	5yzg:H
19	6ah0:H	109	42	0.3231	0.3853	1.0000	6.81e-16	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
20	6ah0:H	109	32	0.2462	0.2936	1.0000	2.47e-10	6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
21	8r09:2	98	38	0.2923	0.3878	1.0000	1.14e-13	8r0b:2, 8rm5:2
22	8r09:2	98	32	0.2462	0.3265	1.0000	2.47e-10	8r0b:2, 8rm5:2
23	8r08:2	97	38	0.2923	0.3918	1.0000	1.14e-13	8r0a:2
24	8r08:2	97	32	0.2462	0.3299	1.0000	2.47e-10	8r0a:2
25	8qxd:2	97	38	0.2923	0.3918	1.0000	1.14e-13
26	8qxd:2	97	32	0.2462	0.3299	1.0000	2.47e-10
27	6qx9:2	94	38	0.2923	0.4043	1.0000	1.14e-13
28	6qx9:2	94	32	0.2462	0.3404	1.0000	2.47e-10
29	8qo9:2	98	38	0.2923	0.3878	1.0000	1.14e-13	8qzs:2
30	8qo9:2	98	32	0.2462	0.3265	1.0000	2.47e-10	8qzs:2
31	6id1:H	136	38	0.2923	0.2794	1.0000	1.14e-13
32	6id0:H	140	38	0.2923	0.2714	1.0000	1.14e-13
33	9fmd:2	120	38	0.2923	0.3167	1.0000	1.14e-13	6qdv:2
34	7qtt:f	76	38	0.2846	0.4868	0.9737	1.91e-11
35	6y50:2	50	32	0.2462	0.6400	1.0000	2.47e-10
36	7onb:H	32	32	0.2462	1.0000	1.0000	2.47e-10
37	7abh:2	37	32	0.2462	0.8649	1.0000	2.47e-10
38	7q4p:2	45	31	0.2385	0.6889	1.0000	8.88e-10
39	7q4o:2	35	30	0.2308	0.8571	1.0000	3.19e-09

[Back]