Home Research COVID-19 Services Publications People Teaching Job Opening News Forum --> -->
Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●DMFold ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP
>rna
uaguaucuguucuuaucaguuuaauaucugau

The query sequence (length=32) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

# Hit Hit
length 		Aligned
length 		Identity
(normalized by query) 		Identity
(normalized by hit) 		Identity (normalized
by aligned length) 		E-value Homologs
to hit
1 5z56:H 136 32 1.0000 0.2353 1.0000 3.38e-11 5z57:H, 5z58:H
2 6y50:2 50 32 1.0000 0.6400 1.0000 3.38e-11
3 7vpx:H 130 32 1.0000 0.2462 1.0000 3.38e-11
4 8r09:2 98 32 1.0000 0.3265 1.0000 3.38e-11 8r0b:2, 8rm5:2
5 8r08:2 97 32 1.0000 0.3299 1.0000 3.38e-11 8r0a:2
6 8qxd:2 97 32 1.0000 0.3299 1.0000 3.38e-11
7 6qx9:2 94 32 1.0000 0.3404 1.0000 3.38e-11
8 7qtt:f 76 32 1.0000 0.4211 1.0000 3.38e-11
9 8qo9:2 98 32 1.0000 0.3265 1.0000 3.38e-11 8qzs:2
10 7onb:H 32 32 1.0000 1.0000 1.0000 3.38e-11
11 8i0r:H 167 32 1.0000 0.1916 1.0000 3.38e-11 8i0s:H, 8i0t:H, 8i0u:H
12 8i0p:H 165 32 1.0000 0.1939 1.0000 3.38e-11
13 7evo:H 148 32 1.0000 0.2162 1.0000 3.38e-11 8hk1:H, 6y5q:2
14 8ch6:f 137 32 1.0000 0.2336 1.0000 3.38e-11
15 6ah0:H 109 32 1.0000 0.2936 1.0000 3.38e-11 6ahd:H, 8h6e:2A, 8h6j:2A, 8h6k:2A, 8h6l:2A
16 7abi:2 164 32 1.0000 0.1951 1.0000 3.38e-11
17 7abh:2 37 32 1.0000 0.8649 1.0000 3.38e-11
18 7q4p:2 45 31 0.9688 0.6889 1.0000 1.22e-10
19 7q4o:2 35 30 0.9375 0.8571 1.0000 4.38e-10

[Back]
Reference:
  • Chengxin Zhang, Xi Zhang, Peter L Freddolino, and Yang Zhang. BioLiP2: an updated structure database for biologically relevent ligand-protein interactions, Nucleic Acids Research, gkad630 (2023).
  • Jianyi Yang, Ambrish Roy, and Yang Zhang. BioLiP: a semi-manually curated database for biologically relevant ligand-protein interactions, Nucleic Acids Research, 41: D1096-D1103 (2013) (download the PDF file).

    • yangzhanglabumich.edu | (734) 647-1549 | 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218