uagggaauaguuuaacaaaacuccugacucauccucaggagauggagguucaauuccuccuucccuaacca
The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7qi6:Ax | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 2.44e-32 | |
2 | 7qi4:Ax | 70 | 71 | 0.9155 | 0.9286 | 0.9155 | 8.91e-22 | 7qi5:Ax |
3 | 8any:Ay | 70 | 72 | 0.9014 | 0.9143 | 0.8889 | 1.93e-18 | 7qi5:Ay, 6zm5:x, 6zm6:x |
4 | 8any:Ax | 70 | 73 | 0.9155 | 0.9286 | 0.8904 | 1.93e-18 |