uagggaauaguuuaaaaaacagcugacuuucaaucagcagauggagguucaauuccuccuucccuaacca
The query sequence (length=70) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8any:Ay | 70 | 70 | 1.0000 | 1.0000 | 1.0000 | 8.61e-32 | 7qi5:Ay, 6zm5:x, 6zm6:x |
| 2 | 8any:Ax | 70 | 70 | 0.9429 | 0.9429 | 0.9429 | 4.04e-25 | |
| 3 | 7qi4:Ax | 70 | 72 | 0.9429 | 0.9429 | 0.9167 | 8.74e-22 | 7qi5:Ax |
| 4 | 7qi6:Ax | 71 | 72 | 0.9143 | 0.9014 | 0.8889 | 1.89e-18 |
umich.edu