uacaagcgaaugagucauucauccuaaguc
The query sequence (length=30) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7vg3:D | 32 | 30 | 1.0000 | 0.9375 | 1.0000 | 3.79e-10 | |
| 2 | 7vg3:C | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 3.79e-10 | |
| 3 | 7vg2:D | 36 | 29 | 0.9667 | 0.8056 | 1.0000 | 1.36e-09 | |
| 4 | 7vg2:C | 35 | 29 | 0.9667 | 0.8286 | 1.0000 | 1.36e-09 |
umich.edu